Stem-loop sequence pbv-mir-216a

AccessionMI0030289 (change log)
DescriptionPython bivittatus miR-216a stem-loop
Stem-loop
   --g      aa     u         cug  a        c  uuaa 
5'    gcugug  uuggu uaaucucag   gc acugugag ag    u
      ||||||  ||||| |||||||||   || |||||||| ||     
3'    cgacgc  aaucg auuaggguc   ug ugacacuc uc    a
   uaa      -a     u         -ua  g        -  uuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE953947.1: 195072-195162 [+]
intergenic
Clustered miRNAs
< 10kb from pbv-mir-216a
pbv-mir-216bKE953947.1: 188143-188237 [+]
pbv-mir-216aKE953947.1: 195072-195162 [+]
pbv-mir-217KE953947.1: 202057-202143 [+]
Database links

Mature sequence pbv-miR-216a-5p

Accession MIMAT0039022
Sequence

16 - 

uaaucucagcuggcaacuguga

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-216a-3p

Accession MIMAT0039023
Sequence

56 - 

cacagugguaucugggauuaug

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).