Stem-loop sequence pbv-mir-205a

AccessionMI0030281 (change log)
DescriptionPython bivittatus miR-205a stem-loop
Stem-loop
   -----     cau   gu   c      u    c        ucgaa 
5'      ccaug   ucu  ugu cuucau ccac ggagucug     u
        |||||   |||  ||| |||||| |||| ||||||||     a
3'      gguac   aga  aca gaagug ggug cuuuagac     c
   guuga     ---   gu   u      c    a        uaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE958769.1: 21161-21249 [-]
intergenic
Database links

Mature sequence pbv-miR-205a-5p

Accession MIMAT0039009
Sequence

16 - 

uccuucauuccaccggagucug

 - 37

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).