Stem-loop sequence pbv-mir-204-3

AccessionMI0030280 (change log)
DescriptionPython bivittatus miR-204-3 stem-loop
Stem-loop
   ---cu    u    -a    u     ug  a     --- g        
5'      uggc cugu  gcuu cccuu  uc uccua   u ccugaga 
        |||| ||||  |||| |||||  || |||||   | |||||| a
3'      auug gaca  cgaa gggaa  gg agggu   a ggacuua 
   uugau    c    cc    -     gu  c     cgg g        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE956236.1: 133453-133541 [-]
intergenic
Database links

Mature sequence pbv-miR-204-5p

Accession MIMAT0039006
Sequence

16 - 

uucccuuugucauccuaugccug

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-204-3-3p

Accession MIMAT0039008
Sequence

53 - 

gcugggacggugaagggaagcc

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).