Stem-loop sequence pbv-mir-199-3

AccessionMI0030273 (change log)
DescriptionPython bivittatus miR-199-3 stem-loop
Stem-loop
   -----------uccacucc    uc       u        c   u   gacu 
5'                    gucu  ccagugu cggacuac ugu cag    a
                      ||||  ||||||| |||||||| ||| |||     
3'                    cgga  gguuaca gucugaug aca guu    c
   acgacacauagggucgugu    uu       c        -   u   agaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE955379.1: 131002-131097 [+]
intergenic
Database links

Mature sequence pbv-miR-199-3-5p

Accession MIMAT0038998
Sequence

14 - 

cccaguguucggacuaccuguuc

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-199-3p

Accession MIMAT0038997
Sequence

53 - 

acaguagucugcacauugguu

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).