Stem-loop sequence pbv-mir-199-1

AccessionMI0030271 (change log)
DescriptionPython bivittatus miR-199-1 stem-loop
Stem-loop
   ---------------c       u        c   u  -------- g 
5'                 ccagugu cagacuac ugu ca        g a
                   ||||||| |||||||| ||| ||        |  
3'                 gguuaca gucugaug aca gu        c a
   agguuuggguuagauu       c        -   u  ggaaacau a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE954297.1: 75307-75382 [-]
intergenic
Database links

Mature sequence pbv-miR-199-5p

Accession MIMAT0038996
Sequence

1 - 

cccaguguucagacuaccuguuca

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-199-3p

Accession MIMAT0038997
Sequence

42 - 

acaguagucugcacauugguu

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).