Stem-loop sequence pbv-mir-196c

AccessionMI0030270 (change log)
DescriptionPython bivittatus miR-196c stem-loop
Stem-loop
   ----   uc      uu          uc     u    cu  a 
5'     ugg  ggugau  agguaguuuc  guugu gagg  ga c
       |||  ||||||  ||||||||||  ||||| ||||  || a
3'     acu  ucacua  uccgucaaag  cgacg cucu  cu u
   uuug   --      cu          ca     u    cu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE953980.1: 281956-282040 [+]
intergenic
Database links

Mature sequence pbv-miR-196c-5p

Accession MIMAT0038995
Sequence

13 - 

uagguaguuucucguuguugag

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).