Stem-loop sequence pbv-mir-191

AccessionMI0030264 (change log)
DescriptionPython bivittatus miR-191 stem-loop
Stem-loop
   ---u   c          c  aa       ---uu   c 
5'     ggg aacggaaucc aa  gcagcug     uuc u
       ||| |||||||||| ||  |||||||     |||  
3'     ucc uugccuuagg uu  cgucgac     gag c
   ucgu   -          -  ca       cuucu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE954653.1: 219600-219671 [+]
intergenic
Clustered miRNAs
< 10kb from pbv-mir-191
pbv-mir-191KE954653.1: 219600-219671 [+]
pbv-mir-425KE954653.1: 223809-223901 [+]
pbv-mir-2970KE954653.1: 225924-226012 [+]
Database links

Mature sequence pbv-miR-191-5p

Accession MIMAT0038987
Sequence

5 - 

caacggaaucccaaaagcagcug

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-191-3p

Accession MIMAT0038988
Sequence

47 - 

gcugcacuuggauuccguuccu

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).