Stem-loop sequence pbv-mir-183

AccessionMI0030260 (change log)
DescriptionPython bivittatus miR-183 stem-loop
Stem-loop
   -------  -         g      a   -guag         --   aa 
5'        uc cuguucugu uauggc cug     aauucacug  uga  a
          || ||||||||| |||||| |||     |||||||||  |||   
3'        ag gacgaggca auaccg ggc     uuaagugac  gcu  c
   ccaagaa  a         a      -   aacca         ua   ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE958924.1: 50043-50134 [-]
intergenic
Clustered miRNAs
< 10kb from pbv-mir-183
pbv-mir-183KE958924.1: 50043-50134 [-]
pbv-mir-96KE958924.1: 47968-48058 [-]
pbv-mir-182KE958924.1: 41416-41510 [-]
Database links

Mature sequence pbv-miR-183-5p

Accession MIMAT0038982
Sequence

13 - 

uauggcacugguagaauucacug

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).