Stem-loop sequence pbv-mir-182

AccessionMI0030259 (change log)
DescriptionPython bivittatus miR-182 stem-loop
Stem-loop
   cucu     uu  u  cu       u -g      uca      -- g  a 
5'     cccuc  gc gu  uuggcaa g  uagaac   cacugg  u ag u
       |||||  || ||  ||||||| |  ||||||   ||||||  | ||  
3'     ggggg  cg ca  aaccguu c  aucuug   guggcc  g uc a
   --cu     uc  c  uc       - ag      ---      ua g  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE958924.1: 41416-41510 [-]
intergenic
Clustered miRNAs
< 10kb from pbv-mir-182
pbv-mir-183KE958924.1: 50043-50134 [-]
pbv-mir-96KE958924.1: 47968-48058 [-]
pbv-mir-182KE958924.1: 41416-41510 [-]
Database links

Mature sequence pbv-miR-182-5p

Accession MIMAT0038980
Sequence

18 - 

uuuggcaaugguagaacucacacu

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-182-3p

Accession MIMAT0038981
Sequence

62 - 

ugguucuagacuugccaacu

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).