Stem-loop sequence pbv-mir-137b

AccessionMI0030236 (change log)
DescriptionPython bivittatus miR-137b stem-loop
Stem-loop
   -u    augc          g   g       ug    --u    ua a 
5'   gacu    ucccuucgau acg guauucu  ggua   auaa  c g
     ||||    |||||||||| ||| |||||||  ||||   ||||  | a
3'   uuga    aggggaguug ugc cauaaga  ucgu   uguu  g u
   cg    ----          a   g       gu    uau    gc g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE953225.1: 228401-228494 [+]
intergenic
Database links

Mature sequence pbv-miR-137b-5p

Accession MIMAT0038947
Sequence

21 - 

acggguauucuuggguauauaau

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-137b-3p

Accession MIMAT0038948
Sequence

58 - 

uauugcuugagaauacgcguag

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).