Stem-loop sequence pbv-mir-130b

AccessionMI0030224 (change log)
DescriptionPython bivittatus miR-130b stem-loop
Stem-loop
   -   ca u   cua       c          a   uuca    
5'  gag  g cug   cucuuuc uuguugcgcu cug    gcu 
    |||  | |||   ||||||| |||||||||| |||    || u
3'  cuc  c gac   gggaaag aauaacguga gau    cgc 
   c   cc -   uac       u          c   -cuc    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE953167.1: 507018-507101 [+]
intergenic
Clustered miRNAs
< 10kb from pbv-mir-130b
pbv-mir-454KE953167.1: 505144-505223 [+]
pbv-mir-130bKE953167.1: 507018-507101 [+]
Database links

Mature sequence pbv-miR-130b-3p

Accession MIMAT0038928
Sequence

53 - 

cagugcaauaaugaaagggc

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).