Stem-loop sequence pbv-mir-130a

AccessionMI0030223 (change log)
DescriptionPython bivittatus miR-130a stem-loop
Stem-loop
   ggcac    -  u      g        c      ug  a  gagcc 
5'      ggcc cc gcccga gcucuuuu acauug  cu cu     c
        |||| || |||||| |||||||| ||||||  || ||      
3'      ccgg gg uggguu cgggaaaa uguaac  ga ga     a
   -gaca    u  u      a        a      gu  c  accca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE953228.1: 125022-125115 [+]
intergenic
Database links

Mature sequence pbv-miR-130a-5p

Accession MIMAT0038926
Sequence

18 - 

aggcucuuuucacauugugcu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-130a-3p

Accession MIMAT0038927
Sequence

56 - 

cagugcaauguaaaaagggcauug

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).