Stem-loop sequence pbv-mir-129b

AccessionMI0030222 (change log)
DescriptionPython bivittatus miR-129b stem-loop
Stem-loop
   --  - uu        -       c   cu         ------    cu 
5'   gu c  cucugggu cuuuuug ggu  gggcuuucu      gggu  g
     || |  |||||||| ||||||| |||  |||||||||      ||||  u
3'   ca g  ggggccua gaaaaac cca  cccgaaaga      ccca  c
   ag  u uu        c       c   uu         cuaugc    ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE953229.1: 75173-75267 [-]
intergenic
Database links

Mature sequence pbv-miR-129b-5p

Accession MIMAT0038924
Sequence

14 - 

cuuuuugcggucugggcuuuc

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-129b-3p

Accession MIMAT0038925
Sequence

60 - 

aagcccuuaccccaaaaagcau

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).