Stem-loop sequence pbv-mir-125b-2

AccessionMI0030217 (change log)
DescriptionPython bivittatus miR-125b-2 stem-loop
Stem-loop
   ------ga   uu     uc  ug   c   a        -g   uu 
5'         cuu  ccuag  cc  aga ccu acuuguga  guu  u
           |||  |||||  ||  ||| ||| ||||||||  |||  u
3'         gag  ggauc  gg  ucu gga ugaacacu  caa  a
   accaaggg   gc     ca  gu   c   c        aa   ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE953041.1: 123172-123261 [+]
intergenic
Database links

Mature sequence pbv-miR-125b-5p

Accession MIMAT0038916
Sequence

13 - 

ucccugagacccuaacuuguga

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-125b-3p

Accession MIMAT0038917
Sequence

53 - 

acaagucaggcucuugggaccu

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).