Stem-loop sequence pbv-mir-125b-1

AccessionMI0030216 (change log)
DescriptionPython bivittatus miR-125b-1 stem-loop
Stem-loop
   -cc   u u uc       c           -  guuuu 
5'    cuc c g  ccugaga ccuaacuugug ac     g
      ||| | |  ||||||| ||||||||||| ||     g
3'    gag g c  gggcucu ggauugggcac ug     u
   guu   u u ga       c           c  aacuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE954744.1: 197624-197702 [-]
intergenic
Database links

Mature sequence pbv-miR-125b-5p

Accession MIMAT0038916
Sequence

10 - 

ucccugagacccuaacuuguga

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).