Stem-loop sequence pbv-mir-124a-3

AccessionMI0030214 (change log)
DescriptionPython bivittatus miR-124a-3 stem-loop
Stem-loop
   --cu      aag c   c        a   ga        uaauu 
5'     uggcuu   c cuu guguucac gcg  ccuugauu     u
       ||||||   | ||| |||||||| |||  ||||||||      
3'     accgaa   g gaa cguaagug cgc  ggaauuaa     c
   cugc      -ga a   c        g   ac        cauag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE955369.1: 120817-120907 [+]
intergenic
Database links

Mature sequence pbv-miR-124a-5p

Accession MIMAT0038913
Sequence

17 - 

cguguucacagcggaccuugau

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-124a-3p

Accession MIMAT0038914
Sequence

55 - 

uaaggcacgcggugaaugccaa

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).