Stem-loop sequence pbv-mir-124a-1

AccessionMI0030212 (change log)
DescriptionPython bivittatus miR-124a-1 stem-loop
Stem-loop
   --cg        u    cc        a   ga        uaau 
5'     aggcucug cucu  guguucac gcg  ccuugauu    g
       |||||||| ||||  |||||||| |||  ||||||||    u
3'     uucgggac gaga  cguaagug cgc  ggaauuaa    c
   gaag        -    ac        g   ac        caua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE957509.1: 32622-32711 [-]
intergenic
Database links

Mature sequence pbv-miR-124a-5p

Accession MIMAT0038913
Sequence

17 - 

cguguucacagcggaccuugau

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-124a-3p

Accession MIMAT0038914
Sequence

54 - 

uaaggcacgcggugaaugccaa

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).