Stem-loop sequence pbv-mir-106

AccessionMI0030208 (change log)
DescriptionPython bivittatus miR-106 stem-loop
Stem-loop
   -ucg   g   aa       u   g     g   ucca 
5'     gug ugc  aagugcu aua ugcag uag    g
       ||| |||  ||||||| ||| ||||| |||    u
3'     cac gug  uucacga ugu acguc auc    g
   guaa   g   ac       u   g     -   ucua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE958055.1: 3743-3819 [-]
intergenic
Clustered miRNAs
< 10kb from pbv-mir-106
pbv-mir-106KE958055.1: 3743-3819 [-]
pbv-mir-18bKE958055.1: 3574-3651 [-]
pbv-mir-20bKE958055.1: 586-679 [-]
pbv-mir-92a-2KE958055.1: 269-363 [-]
pbv-mir-363KE958055.1: 103-192 [-]
Database links

Mature sequence pbv-miR-106-5p

Accession MIMAT0038905
Sequence

11 - 

aaaagugcuuauagugcagguagu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-106-3p

Accession MIMAT0038906
Sequence

47 - 

acugcaguguuagcacuuca

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).