Stem-loop sequence pbv-mir-92a-2

AccessionMI0030197 (change log)
DescriptionPython bivittatus miR-92a-2 stem-loop
Stem-loop
   gag     ---       ug         uu  u   u   ---     g 
5'    cuccu   uccuccg  gguugggau  gu gua uac   ucgga a
      |||||   |||||||  |||||||||  || ||| |||   |||||  
3'    gaggg   aggaggu  ccggcccug  ca cgu aug   agucu u
   uaa     gcc       gu         uu  -   u   aca     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE958055.1: 269-363 [-]
intergenic
Clustered miRNAs
< 10kb from pbv-mir-92a-2
pbv-mir-106KE958055.1: 3743-3819 [-]
pbv-mir-18bKE958055.1: 3574-3651 [-]
pbv-mir-20bKE958055.1: 586-679 [-]
pbv-mir-92a-2KE958055.1: 269-363 [-]
pbv-mir-363KE958055.1: 103-192 [-]
Database links

Mature sequence pbv-miR-92a-3p

Accession MIMAT0038889
Sequence

57 - 

uauugcacuugucccggccugu

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).