Stem-loop sequence pbv-mir-92a-1

AccessionMI0030196 (change log)
DescriptionPython bivittatus miR-92a-1 stem-loop
Stem-loop
   ---u      --------            c   u       ug guu 
5'     uucuac        acagguugggau ggu gcaaugc  u   g
       ||||||        |||||||||||| ||| |||||||  |   a
3'     ggggug        uguccggcccug uca cguuaug  g   g
   gaac      guuggagu            u   -       gu ucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE958468.1: 77447-77533 [-]
intergenic
Clustered miRNAs
< 10kb from pbv-mir-92a-1
pbv-mir-17KE958468.1: 78131-78217 [-]
pbv-mir-18aKE958468.1: 77990-78083 [-]
pbv-mir-19aKE958468.1: 77858-77941 [-]
pbv-mir-20aKE958468.1: 77710-77789 [-]
pbv-mir-19bKE958468.1: 77568-77651 [-]
pbv-mir-92a-1KE958468.1: 77447-77533 [-]
Database links

Mature sequence pbv-miR-92a-3p

Accession MIMAT0038889
Sequence

48 - 

uauugcacuugucccggccugu

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).