Stem-loop sequence pbv-mir-34c

AccessionMI0030195 (change log)
DescriptionPython bivittatus miR-34c stem-loop
Stem-loop
   cau       g    ca   a    a      u     acaa 
5'    cagccuu ucac  ggc gugu guuagc gauug    a
      ||||||| ||||  ||| |||| |||||| |||||     
3'    gucggaa agug  ccg caca caaucg cugac    g
   ucc       a    aa   a    a      -     aacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE957210.1: 113002-113086 [+]
intergenic
Clustered miRNAs
< 10kb from pbv-mir-34c
pbv-mir-34bKE957210.1: 112276-112364 [+]
pbv-mir-34cKE957210.1: 113002-113086 [+]
Database links

Mature sequence pbv-miR-34c-5p

Accession MIMAT0038887
Sequence

17 - 

aggcaguguaguuagcugauuga

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-34c-3p

Accession MIMAT0038888
Sequence

50 - 

agucgcuaacaacacagccaagu

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).