Stem-loop sequence pbv-mir-34b

AccessionMI0030194 (change log)
DescriptionPython bivittatus miR-34b stem-loop
Stem-loop
   aau      ugg    ua       u      c       g  uc 
5'    cauguu   uuug  ggcagug aguuag ugauugu ug  u
      ||||||   ||||  ||||||| |||||| ||||||| ||   
3'    guguaa   aaac  cugucac ucgauc acuaacg ac  c
   gac      -ca    ua       u      -       -  cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE957210.1: 112276-112364 [+]
intergenic
Clustered miRNAs
< 10kb from pbv-mir-34b
pbv-mir-34bKE957210.1: 112276-112364 [+]
pbv-mir-34cKE957210.1: 113002-113086 [+]
Database links

Mature sequence pbv-miR-34b-5p

Accession MIMAT0038885
Sequence

18 - 

aggcaguguaguuagcugauugu

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-34b-3p

Accession MIMAT0038886
Sequence

54 - 

aaucacuagcuucacuguca

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).