Stem-loop sequence pbv-mir-34a

AccessionMI0030193 (change log)
DescriptionPython bivittatus miR-34a stem-loop
Stem-loop
   cucu   -         u         -   a            gug     
5'     gug agugcuucu uggcagugu cuu gcugguuguugu   cgau 
       ||| ||||||||| ||||||||| ||| ||||||||||||   ||| g
3'     cac ucaugaaga gucgucaua gaa cgacuaacgacg   guua 
   --ug   g         c         c   -            -aa     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE958536.1: 10253-10349 [-]
intergenic
Database links

Mature sequence pbv-miR-34a-5p

Accession MIMAT0038884
Sequence

18 - 

uggcagugucuuagcugguugu

 - 39

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).