Stem-loop sequence pbv-mir-31

AccessionMI0030189 (change log)
DescriptionPython bivittatus miR-31 stem-loop
Stem-loop
   auugagagcug     ga     g             ugaugaa 
5'            gagag  ggcaa auguuggcauagc       c
              |||||  ||||| |||||||||||||       u
3'            cuuuc  ccguu uacaaccguaucg       g
   -----------     uc     a             uccaaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE958157.1: 9907-9986 [-]
intergenic
Database links

Mature sequence pbv-miR-31-5p

Accession MIMAT0038880
Sequence

18 - 

aggcaagauguuggcauagcu

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).