Stem-loop sequence pbv-mir-30c-2

AccessionMI0030186 (change log)
DescriptionPython bivittatus miR-30c-2 stem-loop
Stem-loop
   ------u       u   aca        ug g    
5'        guaaaca ccu   cucucagc  u acu 
          ||||||| |||   ||||||||  | || u
3'        cauuugu gga   gagggucg  g ugu 
   uccuccg       u   --a        gu g    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE952992.1: 287017-287081 [+]
intergenic
Clustered miRNAs
< 10kb from pbv-mir-30c-2
pbv-mir-30eKE952992.1: 282979-283073 [+]
pbv-mir-30c-2KE952992.1: 287017-287081 [+]
Database links

Mature sequence pbv-miR-30c-5p

Accession MIMAT0038873
Sequence

1 - 

uguaaacauccuacacucucagcu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-30c-2-3p

Accession MIMAT0038875
Sequence

40 - 

cugggagaagguuguuuacgcc

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).