Stem-loop sequence pbv-mir-27a

AccessionMI0030177 (change log)
DescriptionPython bivittatus miR-27a stem-loop
Stem-loop
   g   g  u  -  ua         u    u       g  u     
5'  acu cc ag gg  gggcuuagc cacu gugaaca cg uugg 
    ||| || || ||  ||||||||| |||| ||||||| || ||| u
3'  uga gg uc cc  cuugaaucg guga cacuugu gc gacu 
   -   -  u  a  gc         -    -       -  c     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE953590.1: 99832-99916 [-]
intergenic
Clustered miRNAs
< 10kb from pbv-mir-27a
pbv-mir-23aKE953590.1: 100351-100422 [-]
pbv-mir-27aKE953590.1: 99832-99916 [-]
pbv-mir-24-2KE953590.1: 99565-99634 [-]
Database links

Mature sequence pbv-miR-27a-5p

Accession MIMAT0038861
Sequence

14 - 

agggcuuagcucacuugugaaca

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-27a-3p

Accession MIMAT0038862
Sequence

55 - 

uucacaguggcuaaguuccgc

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).