Stem-loop sequence pbv-mir-23a

AccessionMI0030170 (change log)
DescriptionPython bivittatus miR-23a stem-loop
Stem-loop
   gcugccugcu gg        ug        uuacc   a 
5'           g  guuccugg  augugauu     cug u
             |  ||||||||  ||||||||     ||| g
3'           c  uagggacc  uacacuaa     gac u
   ------caac uu        gu        -----   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE953590.1: 100351-100422 [-]
intergenic
Clustered miRNAs
< 10kb from pbv-mir-23a
pbv-mir-23aKE953590.1: 100351-100422 [-]
pbv-mir-27aKE953590.1: 99832-99916 [-]
pbv-mir-24-2KE953590.1: 99565-99634 [-]
Database links

Mature sequence pbv-miR-23a-3p

Accession MIMAT0038853
Sequence

49 - 

aucacauugccagggauuucc

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).