Stem-loop sequence pbv-mir-19a

AccessionMI0030164 (change log)
DescriptionPython bivittatus miR-19a stem-loop
Stem-loop
   --    u  u u               --      ---    gg 
5'   gcag cc c guuaguuuugcauag  uugcac   uaca  a
     |||| || | |||||||||||||||  ||||||   ||||  a
3'   uguc gg g uagucaaaacguauc  aacgug   augu  g
   au    c  u u               ua      uug    ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE958468.1: 77858-77941 [-]
intergenic
Clustered miRNAs
< 10kb from pbv-mir-19a
pbv-mir-17KE958468.1: 78131-78217 [-]
pbv-mir-18aKE958468.1: 77990-78083 [-]
pbv-mir-19aKE958468.1: 77858-77941 [-]
pbv-mir-20aKE958468.1: 77710-77789 [-]
pbv-mir-19bKE958468.1: 77568-77651 [-]
pbv-mir-92a-1KE958468.1: 77447-77533 [-]
Database links

Mature sequence pbv-miR-19a-5p

Accession MIMAT0038843
Sequence

14 - 

aguuuugcauaguugcacua

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-19a-3p

Accession MIMAT0038844
Sequence

49 - 

ugugcaaaucuaugcaaaacuga

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).