Stem-loop sequence pbv-mir-18a

AccessionMI0030162 (change log)
DescriptionPython bivittatus miR-18a stem-loop
Stem-loop
         g   uu    cu    u   uc   u    a   -  aa u 
5' auaacu cuu  uguu  aagg gca  uag gcag uag ug  g a
   |||||| |||  ||||  |||| |||  ||| |||| ||| ||  | g
3' uguuga gaa  acgg  uucc cgu  auc cguc auc ac  u a
         a   -u    uc    u   ga   c    -   u  ga u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE958468.1: 77990-78083 [-]
intergenic
Clustered miRNAs
< 10kb from pbv-mir-18a
pbv-mir-17KE958468.1: 78131-78217 [-]
pbv-mir-18aKE958468.1: 77990-78083 [-]
pbv-mir-19aKE958468.1: 77858-77941 [-]
pbv-mir-20aKE958468.1: 77710-77789 [-]
pbv-mir-19bKE958468.1: 77568-77651 [-]
pbv-mir-92a-1KE958468.1: 77447-77533 [-]
Database links

Mature sequence pbv-miR-18a-5p

Accession MIMAT0038840
Sequence

18 - 

uaaggugcaucuagugcagauag

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-18a-3p

Accession MIMAT0038841
Sequence

59 - 

acugcccuaagugcuccuucug

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).