Stem-loop sequence pbv-mir-17

AccessionMI0030161 (change log)
DescriptionPython bivittatus miR-17 stem-loop
Stem-loop
   u     a       -ca        a  g     g   u a  u 
5'  guuag auaaugu   aagugcuu ca ugcag uag g uu a
    ||||| |||||||   |||||||| || ||||| ||| | ||  
3'  cgguc uauuacg   uucacgga gu acguc auc c ag u
   a     g       aug        a  g     -   - a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE958468.1: 78131-78217 [-]
intergenic
Clustered miRNAs
< 10kb from pbv-mir-17
pbv-mir-17KE958468.1: 78131-78217 [-]
pbv-mir-18aKE958468.1: 77990-78083 [-]
pbv-mir-19aKE958468.1: 77858-77941 [-]
pbv-mir-20aKE958468.1: 77710-77789 [-]
pbv-mir-19bKE958468.1: 77568-77651 [-]
pbv-mir-92a-1KE958468.1: 77447-77533 [-]
Database links

Mature sequence pbv-miR-17-5p

Accession MIMAT0038838
Sequence

15 - 

caaagugcuuacagugcaggua

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-17-3p

Accession MIMAT0038839
Sequence

53 - 

acugcagugaaggcacuuguagc

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).