Stem-loop sequence pbv-mir-15b

AccessionMI0030157 (change log)
DescriptionPython bivittatus miR-15b stem-loop
Stem-loop
            g c ua     a  ac          gagaa 
5' ccuugaggu g g  gcagc cg  augguuugua     a
   ||||||||| | |  ||||| ||  ||||||||||      
3' ggaacucca u c  cgucg gu  ugccagacau     a
            g a uc     g  cu          agaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE958055.1: 57363-57444 [-]
intergenic
Clustered miRNAs
< 10kb from pbv-mir-15b
pbv-mir-15bKE958055.1: 57363-57444 [-]
pbv-mir-16cKE958055.1: 56666-56757 [-]
Database links

Mature sequence pbv-miR-15b-5p

Accession MIMAT0038831
Sequence

14 - 

uagcagcacgacaugguuugua

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-15b-3p

Accession MIMAT0038832
Sequence

50 - 

cagaccguucugggcugccuca

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).