Stem-loop sequence pbv-mir-7-2

AccessionMI0030147 (change log)
DescriptionPython bivittatus miR-7-2 stem-loop
Stem-loop
   u          uuau  a     a       u      uc  u  c 
5'  gccggacucc    gg agacu gugauuu guuguu  ug ag u
    ||||||||||    || ||||| ||||||| ||||||  || || c
3'  cggucugagg    cc ucuga cacugaa caacag  ac uc a
   -          ucuu  g     -       -      -u  -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE953793.1: 181528-181617 [+]
intergenic
Database links

Mature sequence pbv-miR-7-5p

Accession MIMAT0038817
Sequence

15 - 

uggaagacuagugauuuuguuguu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-7-2-3p

Accession MIMAT0038819
Sequence

58 - 

caacaagucacagucugccuu

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).