Stem-loop sequence pbv-mir-1a-2

AccessionMI0030144 (change log)
DescriptionPython bivittatus miR-1a-2 stem-loop
Stem-loop
   a      c    c                ac     ugaaga 
5'  ccugcc agag acauacuucuuuaugu  ccaua      u
    |||||| |||| ||||||||||||||||  |||||       
3'  ggacgg uuuc uguaugaagaaaugua  gguau      a
   -      u    a                -a     uguaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE953557.1: 24092-24175 [+]
intergenic
Clustered miRNAs
< 10kb from pbv-mir-1a-2
pbv-mir-1a-2KE953557.1: 24092-24175 [+]
pbv-mir-133a-2KE953557.1: 28060-28147 [+]
Database links

Mature sequence pbv-miR-1a-2-5p

Accession MIMAT0038814
Sequence

14 - 

acauacuucuuuauguacccau

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-1a-3p

Accession MIMAT0038813
Sequence

53 - 

uggaauguaaagaaguaugua

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).