Stem-loop sequence pbv-mir-1a-1

AccessionMI0030143 (change log)
DescriptionPython bivittatus miR-1a-1 stem-loop
Stem-loop
   a  -        ug                gc     ugaacc 
5'  cc ugcuugag  acauacuucuuuauau  ccaua      u
    || ||||||||  ||||||||||||||||  |||||       
3'  gg acggacuu  uguaugaagaaaugua  gguau      g
   a  u        ua                -a     caaacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE957326.1: 96514-96599 [+]
intergenic
Database links

Mature sequence pbv-miR-1a-5p

Accession MIMAT0038812
Sequence

15 - 

cauacuucuuuauaugcccaua

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-miR-1a-3p

Accession MIMAT0038813
Sequence

53 - 

uggaauguaaagaaguaugua

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).