Stem-loop sequence pbv-let-7i

AccessionMI0030142 (change log)
DescriptionPython bivittatus let-7i stem-loop
Stem-loop
   acc     u                 u   -------  u     ugu 
5'    cuggc gagguaguaguuugugc guu       cg cgggu   g
      ||||| ||||||||||||||||| |||       || |||||   a
3'    gaucg uuccgucaucgaacgcg caa       gu gcccg   c
   cgu     -                 u   uagaggu  c     uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE957148.1: 71452-71542 [-]
intergenic
Database links

Mature sequence pbv-let-7i-5p

Accession MIMAT0038810
Sequence

9 - 

ugagguaguaguuugugcuguu

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-let-7i-3p

Accession MIMAT0038811
Sequence

65 - 

cugcgcaagcuacugccuugcu

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).