Stem-loop sequence pbv-let-7g

AccessionMI0030141 (change log)
DescriptionPython bivittatus let-7g stem-loop
Stem-loop
            u        a            ugagg    a ga    g 
5' guuccaggc gagguagu guuuguacaguu     gucu c  uacc c
   ||||||||| |||||||| ||||||||||||     |||| |  ||||  
3' cgggguccg uuccguca cggacaugucaa     uaga g  augg c
            -        c            -----    g ac    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE960235.1: 36273-36366 [-]
intergenic
Database links

Mature sequence pbv-let-7g-5p

Accession MIMAT0038808
Sequence

10 - 

ugagguaguaguuuguacaguu

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-let-7g-3p

Accession MIMAT0038809
Sequence

67 - 

cuguacaggccacugccuugc

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).