Stem-loop sequence pbv-let-7d

AccessionMI0030137 (change log)
DescriptionPython bivittatus let-7d stem-loop
Stem-loop
   g   u       a              c      ------   -      u 
5'  ggu ccuagga gagguaguagguug auaguu      uua gggcag g
    ||| ||||||| |||||||||||||| ||||||      ||| |||||| g
3'  ucg ggauucu uuccgucguccaac uaucaa      aau uccguu u
   -   -       -              a      uugagg   a      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE953102.1: 567794-567888 [-]
intergenic
Clustered miRNAs
< 10kb from pbv-let-7d
pbv-let-7a-1KE953102.1: 568866-568963 [-]
pbv-let-7f-2KE953102.1: 568370-568462 [-]
pbv-let-7dKE953102.1: 567794-567888 [-]
Database links

Mature sequence pbv-let-7d-5p

Accession MIMAT0038801
Sequence

13 - 

agagguaguagguugcauaguu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-let-7d-3p

Accession MIMAT0038802
Sequence

67 - 

cuauacaaccugcugccuuucu

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).