Stem-loop sequence pbv-let-7c-1

AccessionMI0030134 (change log)
DescriptionPython bivittatus let-7c-1 stem-loop
Stem-loop
   ----      a      uu   g   u             uagaauu  a c 
5'     gugugc uccggg  gag uag agguuguaugguu       ac c c
       |||||| ||||||  ||| ||| |||||||||||||       || |  
3'     cacacg agguuc  uuc auc uccaacaugucaa       ug g a
   aguu      -      cu   g   u             ------u  a g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Python_molurus_bivittatus-5.0.2; GCA_000186305.2) Overlapping transcripts
KE953041.1: 92834-92928 [+]
intergenic
Clustered miRNAs
< 10kb from pbv-let-7c-1
pbv-mir-99aKE953041.1: 91437-91523 [+]
pbv-let-7c-1KE953041.1: 92834-92928 [+]
Database links

Mature sequence pbv-let-7c-5p

Accession MIMAT0038798
Sequence

15 - 

ugagguaguagguuguaugguu

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pbv-let-7c-3p

Accession MIMAT0038799
Sequence

59 - 

cuguacaaccuucuagcuuucc

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).