Stem-loop sequence cli-mir-9644

AccessionMI0030124 (change log)
DescriptionColumba livia miR-9644 stem-loop
Stem-loop
    ug  c     u  -    g   u   a    -   uaa 
5' u  cc agagg gg ugug ggu ugg ucuc agu   a
   |  || ||||| || |||| ||| ||| |||| |||   a
3' a  gg ucucu cc acac uca acc agag uca   u
    gu  a     u  g    g   u   -    g   cuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375804.1: 12247013-12247090 [+]
intergenic
Database links

Mature sequence cli-miR-9644-5p

Accession MIMAT0038781
Sequence

12 - 

uggugugggguuuggaucucag

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9644-3p

Accession MIMAT0038782
Sequence

47 - 

ggagaccauacugcacagccuuc

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).