Stem-loop sequence cli-mir-9642

AccessionMI0030122 (change log)
DescriptionColumba livia miR-9642 stem-loop
Stem-loop
   -c a  -     u  --   c     -    u    caaa  c 
5'   g cc agagg ga  gag ucagg ugcc ucuc    uc u
     | || ||||| ||  ||| ||||| |||| ||||    || u
3'   c gg ucucc cu  cuc agucc gcgg aggg    ag c
   ga -  c     c  gu   c     c    c    cacg  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376336.1: 218899-218981 [-]
intergenic
Database links

Mature sequence cli-miR-9642-5p

Accession MIMAT0038777
Sequence

10 - 

gugagagcucaggugccuucuc

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9642-3p

Accession MIMAT0038778
Sequence

51 - 

gacggcgcccugaccucugucc

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).