Stem-loop sequence cli-mir-9636

AccessionMI0030116 (change log)
DescriptionColumba livia miR-9636 stem-loop
Stem-loop
   cg      --     a           c    agaaggga u 
5'   cucccc  gcaaa ccaguggguac uugu        c g
     ||||||  ||||| ||||||||||| ||||        |  
3'   gagggg  cguuu ggucgcccaug aaca        g g
   ug      uu     -           -    ggugagag u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB377187.1: 232473-232554 [+]
intergenic
Database links

Mature sequence cli-miR-9636-5p

Accession MIMAT0038765
Sequence

8 - 

cgcaaaaccaguggguaccuugua

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9636-3p

Accession MIMAT0038766
Sequence

54 - 

caaguacccgcugguuugcuug

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).