Stem-loop sequence cli-mir-9630

AccessionMI0030109 (change log)
DescriptionColumba livia miR-9630 stem-loop
Stem-loop
   cca     a           c           c acc  a 
5'    cccac ccaagagcccc agugucgccgg c   cc g
      ||||| ||||||||||| ||||||||||| |   || c
3'    gggug gguucucgggg ucacagcggcc g   gg u
   acc     c           c           c ccc  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375599.1: 1601151-1601233 [-]
intergenic
Database links

Mature sequence cli-miR-9630-5p

Accession MIMAT0038751
Sequence

15 - 

agcccccagugucgccggcc

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9630-3p

Accession MIMAT0038752
Sequence

51 - 

cccggcgacacucggggcucu

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).