Stem-loop sequence cli-mir-9629

AccessionMI0030108 (change log)
DescriptionColumba livia miR-9629 stem-loop
Stem-loop
   ucu        cac    a    ca    ga    c 
5'    accauggu   ggcc cucg  cgag  gccg a
      ||||||||   |||| ||||  ||||  |||| c
3'    ugguacca   ucgg gagc  gcuc  cggc c
   cac        -uc    g    ac    ac    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376042.1: 23161-23234 [-]
intergenic
Database links

Mature sequence cli-miR-9629-5p

Accession MIMAT0038749
Sequence

12 - 

cacggccacucgcacgaggagc

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9629-3p

Accession MIMAT0038750
Sequence

45 - 

cacucgcacgaggggcucuacc

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).