Stem-loop sequence cli-mir-9628

AccessionMI0030107 (change log)
DescriptionColumba livia miR-9628 stem-loop
Stem-loop
   uguu  u     -  u   u  a   u            g   --  gc a 
5'     cc ucacu ca ggc gc cag cuggcagggcuu cag  ag  c c
       || ||||| || ||| || ||| |||||||||||| |||  ||  | a
3'     gg ggugg gu ccg cg guc gaccguuucgga guc  uc  g g
   -aac  u     c  -   c  g   c            g   ca  aa a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375380.1: 13057802-13057901 [-]
intergenic
Database links

Mature sequence cli-miR-9628-5p

Accession MIMAT0038747
Sequence

21 - 

cacagucuggcagggcuugcag

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9628-3p

Accession MIMAT0038748
Sequence

62 - 

ggaggcuuugccagccugggc

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).