Stem-loop sequence cli-mir-2970

AccessionMI0030088 (change log)
DescriptionColumba livia miR-2970 stem-loop
Stem-loop
   --aca     -   c ug gg        c  u        ----   g 
5'      gcucc ugc c  c  acagucag ag uggucugg    ugu a
        ||||| ||| |  |  |||||||| || ||||||||    ||| g
3'      cgagg acg g  g  ugucgguu uc acuagacu    gcg c
   cccca     g   u gu gg        c  c        cuua   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375561.1: 2757526-2757619 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-2970
cli-mir-425KB375561.1: 2757261-2757351 [+]
cli-mir-2970KB375561.1: 2757526-2757619 [+]
Database links

Mature sequence cli-miR-2970-5p

Accession MIMAT0038713
Sequence

18 - 

gacagucagcaguuggucuggu

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-2970-3p

Accession MIMAT0038714
Sequence

55 - 

cagaucaccucuuggcuguggg

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).