Stem-loop sequence cli-mir-1805

AccessionMI0030084 (change log)
DescriptionColumba livia miR-1805 stem-loop
Stem-loop
   gu    ua   u            c      -    --agc   g 
5'   ggaa  uuc gggaguuguagu uuucaa acag     uuc c
     ||||  ||| |||||||||||| |||||| ||||     |||  
3'   ccuu  aag cccucgacauca aagguu uguc     agg a
   cu    -c   u            c      a    cauac   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375380.1: 6825930-6826017 [-]
intergenic
Database links

Mature sequence cli-miR-1805-5p

Accession MIMAT0038705
Sequence

15 - 

gaguuguagucuuucaaacaga

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-1805-3p

Accession MIMAT0038706
Sequence

55 - 

uguauuggaacacuacagcuccc

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).