Stem-loop sequence cli-mir-1729

AccessionMI0030076 (change log)
DescriptionColumba livia miR-1729 stem-loop
Stem-loop
   uagaca  -   ga      -    c        g    c    g  ucua 
5'       gg ccu  uccugc aucc uuacucac ugag aguc uc    u
         || |||  |||||| |||| |||||||| |||| |||| ||     
3'       cc ggg  aggacg uagg aaugagug gcuc ucag gg    u
   ccauca  a   uc      c    -        -    a    -  cacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375297.1: 27889-27987 [+]
intergenic
Database links

Mature sequence cli-miR-1729-5p

Accession MIMAT0038695
Sequence

20 - 

aucccuuacucacgugagcaguc

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-1729-3p

Accession MIMAT0038696
Sequence

60 - 

cuacucggugaguaaggaucgc

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).