Stem-loop sequence cli-mir-1720

AccessionMI0030075 (change log)
DescriptionColumba livia miR-1720 stem-loop
Stem-loop
   --cugcac   u     -    agc         uguga  - u 
5'         uuc gacca ccuc   cguugcuuu     gc c c
           ||| ||||| ||||   |||||||||     || |  
3'         aag cuggu ggag   gcaacgaag     cg g g
   cuccccca   u     c    --a         -----  a a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375424.1: 999045-999123 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-1720
cli-mir-7a-2KB375424.1: 999171-999264 [-]
cli-mir-1720KB375424.1: 999045-999123 [-]
Database links

Mature sequence cli-miR-1720-5p

Accession MIMAT0038693
Sequence

10 - 

ugaccaccucagccguugcuuuug

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-1720-3p

Accession MIMAT0038694
Sequence

48 - 

gaagcaacgagaggcuggucuga

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).