Stem-loop sequence cli-mir-1467

AccessionMI0030067 (change log)
DescriptionColumba livia miR-1467 stem-loop
Stem-loop
   aca  g        u       c   g  -     a    -   a ca 
5'    gg cagguuuu cucucag uac uc ggugu aauc cag g  a
      || |||||||| ||||||| ||| || ||||| |||| ||| |   
3'    cc gucuaaga gagaguc aug ag ccaca uuag guc c  c
   caa  g        c       a   -  a     c    a   a cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375543.1: 4187731-4187825 [-]
intergenic
Database links

Mature sequence cli-miR-1467-5p

Accession MIMAT0038680
Sequence

17 - 

ucucagcuacgucgguguaaauc

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-1467-3p

Accession MIMAT0038681
Sequence

59 - 

uucacaccagaguaacugagagc

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).