Stem-loop sequence cli-mir-1388

AccessionMI0030064 (change log)
DescriptionColumba livia miR-1388 stem-loop
Stem-loop
   -a c    -   ac    a  a   u u         augg   aa g 
5'   g gaga ggc  cucg gg cug c aaccugaga    uga  u u
     | |||| |||  |||| || ||| | |||||||||    |||  |  
3'   c cucu ccg  gagu cc gac g uuggacucu    acu  g a
   ga -    u   ca    a  c   u c         ---a   gg a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375315.1: 1588254-1588345 [-]
intergenic
Database links

Mature sequence cli-miR-1388-5p

Accession MIMAT0038674
Sequence

17 - 

aggacugucuaaccugagaaug

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-1388-3p

Accession MIMAT0038675
Sequence

56 - 

aucucagguucgucagcccaug

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).